Jelly Babies

Jelly Babies
Author: That Patchwork Place
Publisher: Martingale
Total Pages: 356
Release: 2011-06-07
Genre: Crafts & Hobbies
ISBN: 1604686510

Download Jelly Babies Book in PDF, Epub and Kindle

First the quilting experts at That Patchwork Place® baked up the popular quilts in A Baker's Dozen. Now they present contemporary, unique quilts that Baby can grow up with and still love as a preschooler. Use today's convenient precuts or cut 2 1/2" strips from your stash Select from 14 welcoming quilts in a wide variety of styles Find step-by-step instructions that help you finish in time for Baby's arrival

You, Me and Thing 1: The Curse of the Jelly Babies

You, Me and Thing 1: The Curse of the Jelly Babies
Author: Karen McCombie
Publisher: Faber & Faber
Total Pages: 89
Release: 2012-07-19
Genre: Juvenile Fiction
ISBN: 0571272584

Download You, Me and Thing 1: The Curse of the Jelly Babies Book in PDF, Epub and Kindle

Neighbours Ruby and Jackson get the surprise of their lives when they discover a Thing living at the bottom of their gardens. And when Thing places a curse on the inhabitants of the new house that's been built over his old home, Ruby and Jackson find themselves up to their eyeballs in jellybabies, magic and BIG trouble. I never expected to be friends with a Thing. Well, you don't, do you? You usually think of friends being either boys or girls, or maybe even cute yappy dogs. Well, Thing certainly doesn't fit into any of those categories. Thing is just a... a... Actually, I'm not sure quite how to describe it. "A sort of troll crossed with a fairy crossed with a squirrel?" Jackson suggested, after we first discovered Thing. "I is not a squirrel," Thing purred grumpily, twitching its squirrelly ears. "And not a fairy or a trolly. Whatever they is." By the way, I never expected to be friends with Jackson Miller either. I guess I've got a bit of explaining to do, about Jackson and about Thing. (Oh, and about curses and jellybabies too, And the magic. I mustn't forget the magic!) Contains charming black and white line illustrations by Alex T. Smith

My Garden

My Garden
Author: Kevin Henkes
Publisher: Harper Collins
Total Pages: 46
Release: 2010-02-23
Genre: Juvenile Fiction
ISBN: 0061715174

Download My Garden Book in PDF, Epub and Kindle

The girl in this book grows chocolate rabbits, tomatoes as big as beach balls, flowers that change color, and seashells in her garden. How does your garden grow?

Creation

Creation
Author: Adam Rutherford
Publisher: Penguin UK
Total Pages: 272
Release: 2013-04-04
Genre: Science
ISBN: 0141970227

Download Creation Book in PDF, Epub and Kindle

'You will not find a better, more balanced or up-to-date take on either the origin of life or synthetic biology. Essential reading' Observer Creation by Adam Rutherford tells the entire spellbinding story of life in two gripping narratives. 'Prepare to be astounded. There are moments when this book is so gripping it reads like a thriller' Mail on Sunday The Origin of Life is a four-billion-year detective story that uses the latest science to explain what life is and where it first came from, dealing with life's biggest questions and arriving at a thrilling answer. 'A superbly written explanation' Brian Cox The Future of Life introduces an extraordinary technological revolution: 'synthetic biology', the ability to create entirely new life forms within the lab. Adam Rutherford explains how this remarkable innovation works and presents a powerful argument for its benefit to humankind. 'The reader's sense of awe at the well-nigh inconceivable nature of nature is suitably awakened. The extraordinary science and Rutherford's argument are worth every reader's scrutiny. Fascinating' Sunday Telegraph 'One of the most eloquent and genuinely thoughtful books on science over the past decade. You will not find a better, more balanced or up-to-date take on the origin of life or synthetic biology. Essential reading for anyone interested in the coming revolution, which could indeed rival the Industrial Revolution or the internet' Observer 'The perfect primer on the past and future of DNA' Guardian 'Susenseful, erudite and thrilling' Prospect 'A witty, engaging and eye-opening explanation of the basic units of life, right back to our common ancestors and on to their incredible synthetic future. The mark of a really good science book, it shows that the questions we still have are just as exciting as the answers we already know' Dara O Briain 'This is a quite delightful two-books-in-one. Rutherford's lightness of touch in describing the dizzying complexity of life at the cellular level in The Origin of Life only serves to emphasise the sheer scale and ambition of the emerging field of synthetic biology' Jim Al Khalili 'A fascinating glimpse into our past and future. Rutherford's illuminating book is full of optimism about what we might be able to achieve' Sunday Times 'Fresh, original and excellent. An eye-opening look at how we are modifying and constructing life. Totally fascinating' PopularScience.co.uk 'In this book of two halves, Rutherford tells the epic history of life on earth, and eloquently argues the case for embracing technology which allows us to become biological designers' Alice Roberts 'An engaging account of both the mystery of life's origin and its impending resolution as well as a fascinating glimpse of the impending birth of a new, synthetic biology'' Matt Ridley, author of Genome 'I warmly recommend Creation. Rutherford's academic background in genetics gives him a firm grasp of the intricacies of biochemistry - and he translates these superbly into clear English' Financial Times Dr Adam Rutherford is a geneticist, writer and broadcaster. He presents BBC Radio 4's weekly programme Inside Science and his documentaries include the award-winning series The Cell (BBC4), The Gene Code (BBC4), Horizon: 'Playing God' (BBC2) as well as numerous other programmes for BBC Radio 4. This is his first book. TGTCGTGAAGCTACTATTTAAAATGCCACAGTGAAAGATTAAACGCCCGAAAACGGGGTGATAAATGGACGGTAAGTTCCCGACTAAACGTGTTAAATG

The History of Sweets

The History of Sweets
Author: Paul Chrystal
Publisher: Pen and Sword History
Total Pages: 320
Release: 2021-06-30
Genre: Cooking
ISBN: 1526778866

Download The History of Sweets Book in PDF, Epub and Kindle

A chronicle of confectionaries throughout the centuries—from honeycombs to Haribo. “There is much to get your teeth into within these pages.” —Best of British Magazine We all remember sweets—objects of pure delight and the endless cause of squabbles, fights even, hoarding and swapping; a chance to gorge, suck, crunch, and chew. But they’re by no means just a nostalgic thing of days past, and it’s not only children who love and devour sweets—gobstoppers, bulls eyes, licorice, seaside rock, bubble gum, and the like; grown-ups of all ages are partial to a good humbug, or a lemon sherbet or two—in the car, (annoyingly) at the cinema or while out walking—wherever and whenever, the sweet is there, the sweet delivers and the sweet rarely disappoints. Sweets then are ubiquitous and enduring; they cross age, culture, and gender boundaries and they have been around, it seems, forever. This book tells the story of sweets from their primitive beginnings to their place today as a billion-pound commodity with its sophisticated, seductive packaging and sales, advertising and marketing. It explores the people’s favorites, past and present; but there is also a dark side to sweets—and this book does not shy away from the deleterious effect on health as manifested in obesity, tooth decay, and diabetes. It delves into sweet and candy shops in supermarkets and markets, retro sweet shops, fudge makers, vintage sweets online, sweet manufacturing, chocolate, the grey line between sweets and “medicines” ancient and modern. It goes round the world unwrapping sweets from different countries and cultures and it examines how immigrants from all nations have changed our own sweet world.

Appraising Research into Childbirth

Appraising Research into Childbirth
Author: Sara Wickham
Publisher: Elsevier Health Sciences
Total Pages: 179
Release: 2006-05-01
Genre: Medical
ISBN: 0750688491

Download Appraising Research into Childbirth Book in PDF, Epub and Kindle

This title is directed primarily towards health care professionals outside of the United States. Concentrating specifically on research into midwifery and related disciplines, this book appraises eight previously published research articles that present both qualitative and quantitative research studies. Each of the various elements is analysed - from the methodology through to the interpretation of the results. Each article is annotated with notes and questions, thereby enabling the reader to actively participate in the appraisal. Presents a range of quantitative and qualitative research articles relevant to midwifery practice in a unique workbook format Enables readers to gain hands-on, practical experience of critiquing research Supplementary tools, checklists, mnemonics and tables enable deeper understanding of the process of appraising research Commentary and expert critique provided by lecturers in midwifery research Contains a user-friendly guide to statistics

Just Be Jelly

Just Be Jelly
Author: Maddie Frost
Publisher: Little Brown
Total Pages:
Release: 2021
Genre:
ISBN: 9780316523288

Download Just Be Jelly Book in PDF, Epub and Kindle

"A panicky sardine who loses its group learns to relax and to ask for help from a laid back jellyfish"--

Jelly Babies Annual

Jelly Babies Annual
Author: Egmont Books, Limited
Publisher:
Total Pages: 64
Release: 1991-08-01
Genre:
ISBN: 9780749802752

Download Jelly Babies Annual Book in PDF, Epub and Kindle

Lost Wexford

Lost Wexford
Author: Nicky Rossiter
Publisher: The History Press
Total Pages: 178
Release: 2017-07-03
Genre: History
ISBN: 0750984848

Download Lost Wexford Book in PDF, Epub and Kindle

Over the years trades, streets, buildings, shops and a myriad of other items have gone from Wexford’s landscape. However, this book recalls not only these physical losses but also includes the many items of culture, local lore and other ephemeral heritage that disappears by the week.With chapters on industry, religious practices, entertainment and Wexford characters, this fascinating compendium this can be dipped into time and time again to reveal something new about the people, the heritage and the secrets of this maritime town.

Me, Suzy P

Me, Suzy P
Author: Karen Saunders
Publisher: Bonnier Publishing Fiction Ltd.
Total Pages: 216
Release: 2013-01-01
Genre: Juvenile Fiction
ISBN: 1848778120

Download Me, Suzy P Book in PDF, Epub and Kindle

Fourteen-year-old Suzy Puttock and her three best friends lead an average teenage life, spending most of their time in school, home or hanging out in cafés. Mishaps and cringe moments have a nasty habit of following Suzy wherever she goes, but otherwise life's pretty normal. She's been going out with Danny since forever, her nutty older sister Amber's wedding is taking up all her family's attention and her annoying younger sister Harry is intent on making Suzy's life a misery. When gorgeous new boy Zach starts showing Suzy attention, she wonders if the grass may be greener on the other side of the romantic fence. Before Suzy knows it, she's broken up with Danny, there's a huge rift in her friendship group and life is careering off track. Can she sort herself out before things are messed up completely?